CBrugiaQ_1133


Sequence

>CBrugiaQ_1133 (3 EST) Length=525 GGTTCCGAATGTTTATTCACTGCACTTCTTTATCAAGGCTGTAAAGAGAATTCACAATGTCAGTTTTCTTACGTGGTATG CAACCACAGAATGGCTTTACTGCCAAAACGATAAAGTTTGTGAAACATTGCAAAGGGCTAGAAATTGGATGGACTCATAA TAAACTTAGAAGTCAAGGTGTCGAAGAATTTGTGGAGGAGTATTTGCCACTGATAAGAGAAAATAATCCACACATTAGCA TAAGATTATCTCGAACTCATATTAATTGCGATCCATTTGTAATTGGGATATATGAACATTGTCGTATGAGGAAACGGCGT TGCGACTGGAAGACTAAGCATCAAGTGTTATCATTTGTAGAAGAAATGGCTATTGGTGGAGAAAATGTTAAAGGTCGGAA ACGAGGAGTGAAAACTATACTGCCACGTGGTTTACAATTGTTAGGAATACGGAAACCATTGGCCATGATGTATTTAAAGT TTATAGTGGATGGCCACGAGATCCTCCGGATCCTATGGAAATAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1133: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523281668312AA114468MBAFCE4F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13666282605166AA661122MB3D6V1H09T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13669092605447AA661403MBAFCW3F02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:1:23 on Fri 24 Nov 117.