CBrugiaQ_1134


Sequence

>CBrugiaQ_1134 (2 EST) Length=492 CCGTTATTGTTCGGGCAATTGACGATGGCCCCGACAATCCTGATGAATAATCCTCTGTCTGAATTATTACCCACATGTTC ATGGAAACCTTTATGAACATGACTTTCTGTATCATTTTCACCCGCACGGTCATGTTCATCATGTTCATGGCTTTCCGAAT CATTGTCATGATGATCGCGACATTTACAGTAATAATGGGTTTTCTTTTCGTGATGATCTTCGTCACTGTGTTCCTTGCTA TGACTTTCATGGTTTTCAGAACAGTTGTGATGTTCATGTTTTTCATGCCCAGAATCGTTTTGGTGTTCATACCCATGTTC TTGATGCTTACCCTGATTTATATCCGTTTCATTTTTGCGGTTCTCTTGTTCAGAATGATCTCGTTTTATCCGCATCGCTT GGATATCATTCAGAGCAAGACAGGTATAAACCACAGCCACAATATACACCACTGTCGATCTGTTGATCGTCACCCAAAAA AACTTTNCTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1134: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281840890024H21329AS3ISB297SLBrugia malayi infective L3 JHU93SL-BmL3
3658131019986H64225RRAMCA033SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 18:31:25 on Sat 18 Nov 117.