CBrugiaQ_114


Sequence

>CBrugiaQ_114 (2 EST) Length=749 TGAGATTTTGATGCCTCCTTCTACTATATCGGAAAAAGACAAAGTTAACATTGCAAAATTACGAGAAGCTGTTAAAGATG AGCTTACTCCATACTACGACACCGAATTCAACTTATTGCGAAAAAGACAAGGATCATAACTGGAAAACTTACGACAAGTT ACTACCAAAATGAAGGAATCACTTACTCCTTCGAAAGTCAAAATGGGATAGGGACATGATGGCAAGCAAACCTCGTAGAT CATCCGTTACATACTCACTGGAAGGCTGGTATAACTGGCCCAGCAATAAAAACTCCAAATGCTATTGTTAATATCGAGCA AACTGGACGAAATGATTACTGGGGAATGATACAGACATTCTCAGTAAATGAAATTATGATGGCCAGAACTCAGGATCTTG AATTGTTGCTACGTGAAATAATGGAAATGGAGAAAAAAACTGGCCAACAAGCTACCATTATATATTGTGATGGATTTGAC CGATTTGAAATATTGAACAAAACGTCAGTTGAACTTTAATGAACTGGCCCGCTGGGCGGGTATATCCAGCATTATGAATT GACCATTACGTTGAGATGATCCCACAGATTTGTGCTCCTCAATGCACCGCCATTCATTGGGTTCCTTCTGGACAATCCGT TAAACCGCGGCTTCCAAAAACGAACTCCGNCGAAAATTTCCTATATTTTTGGGTCCAATTTGGNAAAACCGAAATTCCAA AATGNTTGGCTGTTCCCAAAACNTTTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_114: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809481235917N74786SW3ICA1394SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8944431887868AA253519SWMFCA1406SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:42:11 on Fri 24 Nov 117.