CBrugiaQ_1142


Sequence

>CBrugiaQ_1142 (5 EST) Length=647 GTTTCAATTCATTTTCAGAAGGAAAGGAATGCTTATCATATCATTTTATTTATTATTTTGTTACATTTATTTGATCAATT CGAGAACAATCACAATTAGAATTCCTGAAAGTGCTAATCCGGATTTTCCGTATGAAACAGCTGTGGAACAATTTAAGCGA TCAGATCAAAATGGTGACAATAAATTATCATTTGAAGAATATCTTCATCTGGATTTGCTATATGAAAAGATGAAAAAGTT TGAATTTGAACAAACTGACAAGAATCACGATGGATTTGTTTCACGTAGTGAATATGATGCTGACGAGAATGTGAAACAAC AAGAAGTTGATAAGCGACAAGCGCAATATTTTAGCCAAATTTATGAAATATTCGATGAAAACTTAGACTCAAAATTGGAC ATCAAAGAGGTGGAAAAAATCTTGGCTGAACGATATGGCCTGAAACCTCGTTCCAATTTCCATTCTATATTTTACTCATT TGATACAAATAATGATGGTGGCCTGGATTTGTCCGAATATGTGAAATTTGATAATAATGTACCATTCGAGGAGATGGATC CACTAGATGACACTCCATTGTCATCAGGTAAACTTGCCCGAGAAAAGTTATTGATTCAAAAATCAAAATCATTGGTCAAA ATTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1142: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343534973938R95208SW3ICA387SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5801191382120W59906SWAMCA784SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6806841547247AA054913SWAMCA1502SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8984451893050AA257574MBAFCZ1E6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482732064920AA406928MBAFCZ6H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:49:5 on Fri 24 Nov 117.