CBrugiaQ_1144


Sequence

>CBrugiaQ_1144 (2 EST) Length=499 ATAAATTGCGCATAATTATGGTACATNTGAGCTAATTCGGATGCAAATAAAGATGCTTCNACACCACCCAAAANCTTGGA GTGATTTCCAACTNGACAGTTGTCCAACCCAAACCGTAATTCGGGTAACNAGGTATTACCTAACATCGGTTTAATTTTGT TAACCCAACACTATCCCAATTCCCTCCGTTAATTGTTCCACTATCCAACNTTCGCAATTTCTTGGATTTCTGGATCATTT CCCTCTTTCAGAAGTAAATCTAACTGAGTGAGCATTTCCAATTTATCGTAAAACTTGTGAGCCAATGTTGTTACGGATTC TAAATGTGTGACTAAAGCAGAATTATTAATCCTCGATTCGTCCTTCCCATCCTTCTGGAGTGCTTTCAGTTTAGAGAATA TAACTTCAAAATAGGTTCGTGCCGTTTCTGTACGAAGCAGATCGGCACAACGACTCAAGAATCGTCGTTGTATCGAAAGC ATATACGACAACTTCAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_1144: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447111167608N43226SW3ICA1148SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13669312605469AA661425MBAFCW3H02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 5:53:44 on Sun 19 Nov 117.