CBrugiaQ_1147


Sequence

>CBrugiaQ_1147 (3 EST) Length=473 GTTTATTATCATGTTTCGCAGAACAAGTGATATCTTCCGAAAAACATACAAAATTTCGGTTCTCAAAAACATGCTTACCT TGGAGGAGCAGTGTTTGCTGCCGCAGCTATCGCCCTTAGTGACGATGAGCTCAAGAAACAGCCTATGTGGTATCAAACGT CTGTGCGTAAGCTATCATTTGCGATAAAATATACGAATCGAAAAGGCTATTTGGATGATGTAATATTACTGGAGAATCTT CGTGAGAAGCTTTATCCATATTCGGACTCAACGAACACCGACCTCTTATGGCGGTATGCCCGAGTACTACTCGAAATTGC TTTGTGGACTTCAAGTGCCGACAAAAACCGAATGGCTACATTCCTCGAGGGGGGGCCGGCACCAATCGCCTATGATGAAT GAAAGTCCACAAAGCCCAAATGCCAGTGCACACAAATGGTATGGAATAACTCTGGTAAAGTTAATGGATTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1147: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445511167352N43050SW3ICA1046SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4458711182888N44369SW3ICA1207SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10750782113555AA430798RRAMCA1465SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 22:24:12 on Sat 18 Nov 117.