CBrugiaQ_1149


Sequence

>CBrugiaQ_1149 (3 EST) Length=484 AAAAAAAGACACACACAAATTTTAAAAAATTTCCCGACCAAAAAAAAAGCGAGATTAAAATTAACAGCTTAAAAAAATGC ATGAAAAAAAGAAAAAAAAACCGTTGCCTTTAATCTTCTTCACTGTTACTTCTTGTATTTTTTCTTTTCTGCCTCATATC GCTGCTTATCCTGGCTGGCCATTTTCTCGTACTTGCTCTTATCTTTTACCTTGCCCCATTCAACACCTGCTGCTTTGCTC ACATCAATGACAGACATGCCAGGTTTCGCTATACGAGATNTATTTTCCAGCAACCAGAACATGTAAGCTGACTTGGCTCG CTTCGGTGCATTCGGATCTTTGACTTTCTTCGTCTTCTTTTGCTTTGATGTTGATGCTCCGCTTGACCTTTTACTTGACT TTTTTGATCCCTTTGGCCCTGTCTTAGCCATGATGGTGAATGTTAGTGTATGGTAAGTAGTAAGATGTAAACTTGAAAAA CCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1149: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7472161660826AA109356MBAFCE1A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566311673256AA118207MBAFCE6D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10989512168121AA454452MBAFCX1G11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:58:20 on Fri 24 Nov 117.