CBrugiaQ_115


Sequence

>CBrugiaQ_115 (2 EST) Length=746 CATATNGGGGAATGGGTACNGCCCCCCCTTGGGTATTTTTTCAAATTTTCGGCAAGTTTTAAAACAACGCCCAAATTTTT TCACAGTGGCAATCNATAGTGTGGGAACATTATCATTGGTATTGGGGGAANTTCCGGGAAGGAAAATAAATTAAATTAGG TCAAATTGAAGGAGCAAAAGTTACCAATAAATTTATAATGCATATAATTTGGGAAAAAAACATGGCAATAAAAACCGTTC TGCACGGTATTCTTCGGATTGCATGGCTTGAGGCGTCCCACGGTTGAACATGTCGGAAGACTGCAGCTATTCTATCGACC CATAAAACCGGATCACGAACTCAAAAGATACCATGAATCTGATGCATTCTCGTTACTGTCTTGTGGTTCGTTAGGTGATA TATCCACCTTTGATTTAAGAAGCTAAAACAAAATAATTGAATGAGAAACAATGTAATAAGTAAAATGTTCAAATAAAATT TAGTGCATGAAAATTTTCAAAAAATATAGTTTGGATGGAAATAAAAATTTTGAGAATAAAATCTACTTCAGCCAAATTTG TCGTCTGCGGCTCAATTAACCGCCTTAACCGGGTTGCAGTTTCTTCTCCTGGTAAACCATTCAGCATTGAAGAACAAGCT AAAAAGATTAATAATAAATTTCACTGTCAATCATTCACAAACAATTTCTGGATAATAATTTTTGCATTAAATTAGTCCAA TCTATGGCTCTTAATTGATAAATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_115: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713011854957AA232036SWMFCA1296SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212892345186AA570893SWMFCA2664SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:24:2 on Mon 20 Nov 117.