CBrugiaQ_1154


Sequence

>CBrugiaQ_1154 (3 EST) Length=480 GTTTGAGGAATCAATAAGAGCTCTGCAACAATGACAAGTGCGCAATTCTCATTTTTTACGTCACCATTACTGCTCTACGT TCTCAGCACACTGATATTGTTAGCAACACCTCTGAGATTGATTCCGGCATTTGACGACGACTTGGGCGAAAACGATGAAA TTCCCAATCAAGAAAACATGGATGAATTTGATGAAAACACTGAAGTTATGCAAGATGGCATCATTTCTATTGAAAGTTCA TCGTGGAATACTACCACACAGATTGATAGAATTGTGCTAAACGGACTCTTAGGGGAAGGATATATCAATGAAACAATGCA ACCATGGAACAGTGGTCGACCACTTCTGATTCGAGTTTTTTGGGCAGTTAGGGCTGACAATGTTACTCCAACTTATCCGA TTTTGAAATCTTACATGAAACTTAATGTTTGTTAAAATTCTGTTGACATTTGTTGCTGAAATAAAATTGAGATTTGTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_1154: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291630902162H31006SW3ICA273SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6838051550564AA057924SWMFCA926SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9214831923334AA280473SWMFCA2022SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:15:26 on Fri 24 Nov 117.