CBrugiaQ_116


Sequence

>CBrugiaQ_116 (6 EST) Length=781 TAGGCCCGGGAGGATGGTTCCTTCCTAAAATCAAATTCGCAGGCATGCAGCTAAATTCACATGTCGAGTGATATTCATAA CACTGATATTCAACTAGAAGTTCGGACCTTTGGAAATAACGCGAGGCAACACGCAACATTATATTCTTGACGCGGATGAT AAAATTCAGCCAATCCCCCAATCAATAAGTCTTAATGTTCGTTTTTCATGGTCGATCATAACATTGTGTGGCTTAAACAT CCCCGATGCATTATGCCCTGCGAGTGACAGTAGTCAAGGGCTTTCAACAATTCGTATAAATAATAACGGATATCGTAATC AGTCAGAGTTTGATAAAGCTGCTTGAAATCAGTATTATTGACATATTCGAAAACAAGTGCTGGAGTACGAGAAATAGGAT CCTTCACGACATCCAGCAGTGTGATAATATTTGTTCCTCCTCTTAAATTCTCCAAAATCTTGATTTCACGCTTTATTTTC TTCTTTTTAACAGGCTTAAGAATTTTGATAACACATTTTTCATCTAACGGTGATTTGACACCCTCGAAAACTTCGCTATA CTTGCCACGTCCTAATTTCCTGATTAACTGATAATCGTCTATATTACCCCATTCTATCATGTGACATTCATAGTCCCAAT ATTCACGAGGTTTCTGCTGATTGACCTCGGCGTAGACGCTTGCACGACTCGGTATTGGCATACTCCTCCCGGGTTGCTCC TCTTCTACACTTACATCCATCCACACCTCATCGAGAAGACACACACGCAAGACAACCTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_116: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4811831237153N74844SW3ICA1410SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6363471486112AA022330SWMFCA444SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6676311537111AA051944SWMFCA829SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9141071912477AA273103SWMFCA1929SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10483072064954AA406962MBAFCZ7D01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10988012167971AA454302MBAFCX0A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:28:52 on Mon 20 Nov 117.