CBrugiaQ_1165


Sequence

>CBrugiaQ_1165 (2 EST) Length=481 CAATTAATGCATTTAACCATGCCCTGTTTGCGTGCATGCATGCATGCATTTATGTAGGAATCATTTCGCGTTCCTCATCC GGAAATATAGTTTCCCAAATTTAAGACACCAATATCAAACACTTTCTTAGCTGTTTTACCTTCGCTAATATAACTGGATG GAATTTTAAATTTTAATTTTCGTTGTCCCAGCTTTAGATTATCATCGCAATCATGGTATACTTTAAATACTGGATCAATT GTAGTTAATTCAGCAGTATCACCTTTCAGCATAAACATACCTTGATCATCAGTATATCCCTGAGCTAGAAGGTCACCCGG ATCAGGCCCGGAATCTTCTTCCCAAAGTTTCACTCGAACATTTCGTGCAGGAGCATTACCACACAATAGTTTACCTTTGA CCGCAACAGCTTGTTGTCTCAATGCTGTTGAAAATGTCACAACGCCAAGTATTAGAAAAAGTAACCAAAAATGCATCCTC A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1165: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4426751164823N41225SW3ICA1060SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11887462289610AA542698MB4SLY2C03T3Brugia malayi L4 JHU93SL-BmL4


Date: 19:23:42 on Fri 24 Nov 117.