CBrugiaQ_1168


Sequence

>CBrugiaQ_1168 (7 EST) Length=599 CTTTATCGCTGCACAGATAGAACTTTTAGAAGTCAACTAAATAACTCTTCGAGTTTCATTATTATTTCGACTTATTATAT GTCACAGCAGGAAGATGCTTTTCTATCTGCTGCTACTTGTTACATTGGTTAAATCACAAGTACAACATACAGTTATCAAT AGTTTCAACAATAATGTCATCTGTGTCAACAATGTTTGCTATGATGCCAATGGCCTATTTGTTTCTGGTGGTAACGGATG CTATGTTATTAATGGAAAAATCTACAAAAATGGCGTGTATTTACGTGATATGACACCAATGGATTATCGAAAATTGGAAA TCTATAATCAAGAAGTAAATCGCTGGAGTGTAGATCTTCAAGATAGTATACAGCGTAGTTTTCCATGGGATGTACGAAAT CCATCACATACGGAATTTCCATGGAATATGATGTCAAGAGACAAGCGCCACATAAATGATCAGAATCGTCGTCACAGACA TAAGCGATTCATGCCTTTTCCAGTGGTACCATATTTCTGTTGAGATTTTTCTTTATCGTAAAATAAAAGAGAAAAGAAAA AAGTTAAATGATACATTAAAAAAAGAAATGAAATAAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1168: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5072501271734W00320RRAMCA1135SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7062171592635AA072534MB4SLD052T3Brugia malayi L4 JHU93SL-BmL4
7472401660850AA109380MBAFCE1C06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984991893104AA257537MBAFCZ2B6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480852064732AA406766MBAFCZ4B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481172064764AA406655MBAFCZ4E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10750842113561AA430879RRAMCA1472SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:33:41 on Sat 25 Nov 117.