CBrugiaQ_1171


Sequence

>CBrugiaQ_1171 (10 EST) Length=499 GAATGATTCCATCACTTTTATTCATAAGCGGCTTACAAAGATATTTTATTCCAATTATAATAAAGATTCAGCTTATACTA GCATACAATCAAAAAGTTAATCACCCTAAAGAATATCTACCAACAAACAGGAACCAAAACACTCATTAAGATTGTGCGCT AATCCGTAAAGCTGTCGCAATGATTTGCTCCTTGCTCTGCACTTTCAGCGCTTCAGCTTCAGCTTTATTTTTTGCGCTTC GCGATCGAATAAACAAGAATAACAACAGATACGTGTACAACCTTGCACGACCACGGTTTAAATAACACGATTGTTCTTTA AGCCAAAATCTTCCTTCCCACCACTTGTACATCGGTCGTAAGATTACATTAGTCTTCATTGTATGTACCACTTGACCATA CAAATGAGCTGCCTGCCCAGCAACTTGCTTTATCAATGTAAATCCTTGCTTCACAACTGCTCCCTGAGCCATCTTCACTC AAACTTGGGTAATAACCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1171: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217672808494R47607AS3ISA023SLBrugia malayi infective L3 JHU93SL-BmL3
217691808513R47626AS3ISA093SLBrugia malayi infective L3 JHU93SL-BmL3
276431881997H16493AS3ISB299SLBrugia malayi infective L3 JHU93SL-BmL3
276432881998H16494AS3ISB268SLBrugia malayi infective L3 JHU93SL-BmL3
3644761017403H63057AS3ISB142T3Brugia malayi infective L3 JHU93SL-BmL3
4156271122571H98349SW3ICA500SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7620181681886AA123575MBAFCE8A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8981691892774AA257285MB4SLM1A5T3Brugia malayi L4 JHU93SL-BmL4
11887642289628AA542716MB4SLY2D12T3Brugia malayi L4 JHU93SL-BmL4
12617092392905AA585493SW3D9CA031SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 2:39:0 on Thu 23 Nov 117.