CBrugiaQ_1176


Sequence

>CBrugiaQ_1176 (3 EST) Length=602 TCNCGGGTGNANCTATCNCTCCTCTGNGNCNCTCGTCTTCCTTTGATCTCACTGGGANCNATCNATGGACAAAGTGAACT GAATGGCAGTGCTCTTCTCCCATAATGCTGCATGTGCANAAGGCAGTTTGATGATGACAAGAGTTGGTGCTGTAGCTAAA TGACATCCGGAAAAAAGTGGCTCAGTCAGCACCTGAGCTATCGAAGCGGTGTCGAACGTTGATCAAATGTTGGCANAAAT TGGCTGAACCGAAACCAACGTCTAGTGGTTCTTCTTCTGCCAATGGTACTCCCAGCTACGCTTCTCCGGCAGTCAAGAAN GGTCTTACGCCAGGTACCCCTGCNAGGGGTCCACGAGTTATTTCCGGTGGCAGTCCACGCCTTACACCTGCTGAAAAATC TCGCTTTACAGCTTTGCCCAGTTCAGTTCCTACGCCATCTGAAANTTCCGGTTCGTGGAATACTGATGCTTCACCAAAAT TTTCAAGATGGGGCGATACGGTTACTCCTGACCAAGAGATCTGAACAAAAAATGTCAGCGAATATGGTAGAAAATGACAT GGAAATCACATGAAGCGTAGTGCTTACCTTCCACTAAATGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1176: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7062081592626AA072472SW3ICA1653SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10481282064775AA406718MBAFCZ4F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10901972158568AA445903SWMFCA2028SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:49:48 on Wed 22 Nov 117.