CBrugiaQ_1188


Sequence

>CBrugiaQ_1188 (4 EST) Length=856 CAGTTTATCAATCATTTCACCAGCATTCTTGCTTGCTGAATCCATGGCAGTCATTCGGGAACTCTGTTCAGAAGCAGCAG ATTCTTTCAGGGCATAATATAGCAGTTGAGCTAACGAATAATTAGCATAATCGTTTAGCACATTGTTCGTCGATTGAGTC ATACATGGACATTGTTGGTTGCTTCACAATAGCATCCAAAGTAAACATTGGTATTATAGATGTTTTATATGAAACAACAG ATCTGAACTTATTGTACAATATAAATCCCTTATCAAATTTGTAATTCGATGACAGGATTTTGGCAGCGATAACTGAAGCA TCCTCAAAAGTTGGAGGCAGTCGGCCAATTTCATTGCATGAGAACAGAACCTGATTTGCGTGAAGAATTTGCATAGATGC TTTAGCTTTGTCACCAATAAGTACCAATTTGTATTCTGCTTCTGATGCTTTTTCTGTCAGTAGTCGTTTAGCTTCCTTTG CAACAGCTGTGTGTACAGAGCCGCAAAGTCCTCGATCTGAAGTAATCAACACCAATAAACGTTTTTCTTTTTCTCCCGAA GTTATAGTACCTTCTTGAAGTTTATCCTTTGATTCTGCTGCACCAATATTATTGTAGAATTGTAAGGCACCAACACCGTA TACTCGANCACCTCTTAGCTCACGTTCTGCCTTGTTATACTTTGCAGCAGATACCATCTTCATACTCTTCGTGATTTTTT GGATATTTCGGACAGATTTCAATCGAATTGAAATATCTTTTAGAGTTGCNAAACCACGGCGTTGTTCGATGNCAGTAATT CCCCAACNAATTGCTGATAATTTCGAACCAAACATTTTACCTCAAACCTCGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1188: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5931131397383W84926SWAMCA1079SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8985271893132AA257655MBAFCZ2E6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161872199328AA471564MBAFCX3H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813502655470AA675764MBAFCW4E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 7:32:1 on Sun 19 Nov 117.