CBrugiaQ_119


Sequence

>CBrugiaQ_119 (2 EST) Length=939 AAATAATCCACACCGTGCATGTTAAAGCATTTAGTATTTTAGGACTTACAGCCATTAACAACAANTGTATGACATCCAAA TGATTCAAGGCGTTTTGCCATAGCATCAGCATCATGTCCTAGCNTTGTCTGTGGCGTTTGTCNTAGACGATTCATGTCTA CGATGCAACCAAATTGTCCAATTTGTAGTATGATGCAAATGTGCAGNTTCCCACACNGAACCTTCAGCGCATTCACCATC ACCCAATAGACAATATACACGGATAACTTGCATTATCAATATATTTTCCAGCATAAGCCATTCNTGCAGCACATGAGAGG CNTTGTCCGAGAGAGCCAGTAGCAACATCGATAAAGTCTAGTCGTGGCGTTGGATGACTTTCTAGATCACAAGTAACCTT CCGTATATTCATCATATCAGATGTTGATATATGTCCCGCTTGATGCCATGCAGCATACAGTACCGGGCATGCATGACCCT TTGATAAAACGAAACGATCAGAAGATGGATTTTTTGGAAATGTTTTGTCAAACTTCATTTCATTAAAGAAAAGAGTTGCA ATAATCTCCGCAGCTGAGCACGAACTTGTGGGATGACCTGATTTAGCTGCACAAGTCATTTTGATCGAATCAATACGCAG ATGATTTGCTACATCATCCAACTGTTGAATATCTATTTTTCCCATTGTTGAATTTAGTAAGCGTTATTGAATTTCCCTCG TGCCGATTCGGCACGAGAAAAGATATCCAGCTCAATAACTTTACTGACCGAACTTCAGGTCTGATTGAATATCTTTTCGA GCTTGCAAACAGTTCTACGTTCTTTACTCTATCACGACTAAAATTGCTGCTTTTTACTGCCTGCCTTCATTTCAAACATG CATGTATGACGCTTTTATTCAATTAGCAGAATTCCAAACAATATTAAAATACAAAATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_119: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5406951313873W32843RRAMCA1222SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12213222345219AA570926SWMFCA2759SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:20:38 on Fri 17 Nov 117.