CBrugiaQ_1195


Sequence

>CBrugiaQ_1195 (7 EST) Length=471 CAAGTTTGACGGAATTTGAAGATAAAGAAGTCAAGGTGCTTTTTTGTTGAAGTTGGAGTCGAGCAAATATTACTAGCGAA ATATGGGTGATTCTGTAGTAACAATTCGGACGAATAAAGTGATGACTAATCGCTTGTTGGCAAGACGGCAAATGGTGGTC GAAATCCTTCATCCTAATCGAGCATCAGTTCCTAAAGTCGAGGTTCGTGAAAAGTTGGCTCAGATGTACAAGACCACTCC TGATTTGGTTTTTACCTATGGTTTCCAGTGTCACTTTGGTGGTGGAAGGAGTACTGGTTTTGCTCTAATCTATGATACAG CAGATTTCGCCAAAAAATTCGAACCAAAATATCGCTTGCTGAGACAAACGGGCACGAAGGCTGAGAAATCAGGTCGCAAA CAGCGCAAGGAGCGTAAGAATAGGCAGAAGAAAGTACGTGGAACAAAGAAAACTAAAGTTGCTGCCAGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1195: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002031737586AA161576MBAFCF1D04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8809631870947AA241577MBL2SJ2G11T3Brugia malayi second stage larvae JHU96SL-BmL2
8985411893146AA257669MBAFCZ2F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480222064669AA406677MBAFCZ2F10T3ABrugia malayi adult female cDNA (SAW96MLW-BmAF)
10482812064928AA406936MBAFCZ7A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11939542315106AA547905MB3D6V2E12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12618552393051AA585639SW3D9CA377SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 12:40:22 on Fri 17 Nov 117.