CBrugiaQ_1198


Sequence

>CBrugiaQ_1198 (2 EST) Length=474 AAGACGGTTGAATATGGCAGAGGAAGAAGCTATTGGAGTTACAAGACTTAAAAAAGAACTATCCGATATTCAAGAAATAA AATTTAAACTGTATGAATTAGAGGATGCCGGAAAAAGCAATCCGAATAAGCTGGTTAGTATCGCTGTTGCCGGATCGATG GCCGTACAATATCGGTGGCTATAAAGTAGAAATTGAATTCACTAAAGAATATCCATTCCAACCACCGAAAATCAAATTCC TCACCAAAGTTTATCATCCTAATATCGATGAAAAAGGAGAGGTATCGCTAGCCATGGCACTTAATGAGAATTGGAAGCCA TCCGTCAAGATTGATCAGTTGTTAACTGCACTCACGGAGTTACTATGCTCGCCACAGCTTGGTTGTGTACTTCGTCCTGA TTTAGCTGAACTCTACGTCAAAGATGTTGATGCGTACAACAGAAATGCATCAGAATTTTGTAAACATTATTCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1198: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217742808564R47677SWAMCA128SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13860742660436AA680488SWAMCA3085SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 5:5:32 on Tue 21 Nov 117.