CBrugiaQ_12


Sequence

>CBrugiaQ_12 (2 EST) Length=928 TTTATGACCATGGACCAGATCCAGTCGTTGTAGATGATATTGCTCTCGAAAAAATGGTAACTAATGGAGCAAAACCTGCT GTGACTCAAATTGCCACCAATTTCTCGGTACCACCACCTGGTTACACACCGCTGAACCCTCCACCTCCTGGTGTTGACAA TGTATATGCTACAAATTCAGCCACTGTTGTATCAGCCGCTCTTTCAGAAGGATATAATCCTGAGGCTCCAGCACTGAGCG CTTCTTCGTTACCAATTGTAGCAGCAGCACATTCGCTAGATTTTTCGGTACCGCCACCACCGATTCCTTCAGTAGTAGTA AATCAGCCTTGGAGACCAACAACTTATACAGTACCTGCCATATCATCATCTGTTTTGATTCATCCTGCGGCTAATACCTA TGACCCAACGCATTCCTCCACTACTCTTCCGCCGCATAATATCACCCAGCTAACAGCTGGTCTAAAACGACGAAGAAAGA AGAGGTAGTTGCTAATAACGCAGGACGGTACAGTCAAATTGTGGGTTGCTGTTGAAATAAGACGCTTCAAGTGCGTTAAG ATACCTGCAGAAACTGAACAATATTGCAAAACTGAATGAACACTTTGGGACAATTCGGGCAGATCCGTTAATATGCAGGT TTTGTTTCCANGGTGATCCAAAAANCAGCACTTATTACTTATGCNAATCGATATGAAGCAGTTGCAGCATATAAAANTAA GTGGCAATACTCAACNATCGTTTCATTAAAGTTTTTTGGGCCAGTACNAATGGACAACCAATAATACTGTTAATGCAATC AAANAGGGCCAACNAAAANTTCATCGGTAACATTTAATGCCAAAGGGCCCTTACAAAAANATCCCTGTTNGGTCNCGGGT GGCTTGGTCTCTGTTAAAAATCCCAACATACTTCCNCGAAATCCCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_12: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7496761663680AA111790SW3ICA1883SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12354212369516AA584963SWMFCA2691SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:27:21 on Wed 22 Nov 117.