CBrugiaQ_1207


Sequence

>CBrugiaQ_1207 (6 EST) Length=410 AAAAAAAAAAATCCAATGTTTTTTCTAAATTAAAACAATTTGGTGTAAATAATCGATCGACACAAGAAAATAGATCTAAC ATATATTTGGNNTACATATATACACATAAACATATATTTGTNTGGATAAGTGCTGTAAATGTGGTGGAAGTATCACAAAT GAACAACCAGGTTGTACAGCAATTGGTGAAATGTTTCATACAAAATGTTTCACATGCAAGGAATGTGATAAACAACTTGC TGGTGGCTCATTTTATAATGTCGACGGNTGTCCACTTGGTGAGGATGATTATATGAAATCATTAGAGAAATGTAACAGGT GCGGNAAACCAATTACGGAAAAGTTGTTACGTGCAACCGGAGGTGCATATCATCCCGGATTGCTTNGGNTGCAACCCCNT GGAAAAANTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1207: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4427101164858N41260SW3ICA673SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448111167708N43188SW3ICA906SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448311167728N43330SW3ICA966SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4458771182894N44375SW3ICA1213SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4458931182910N44391SW3ICA1259SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061581592576AA072503SW3ICA1504SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 12:1:14 on Mon 20 Nov 117.