CBrugiaQ_1210


Sequence

>CBrugiaQ_1210 (2 EST) Length=521 TGCGGTTGGAAGTCGTCTTACTGCTTTTATTGTTCATAAGAAAGTCAAGACAAGCTACCAATGCAAAAACATTGGATATC AACTGCATGTTTCTTGGATATCCAGAATTAGAATATGACGGGTTTGACCGAACTGAGGTTTTAAGTGAAAAAAATTTTAA TAAAACGGTGCTAGCAAGCGACTCTAGAACAATTGTTTTTTTCAACGACGTTGAAAAAGATGATCCCGAATTGGATCAAT ATGAATGTTTTTTACAATTATCGGCTCAAATAATGACAAAACGAGGATACAGTTTCTACACTGTAAATACGACAAAAGAG ACACGATTAAGGAAGCAAGAAAATGTTTGAAAAAGGCGAGGATACTATACATGTTCTATAAAGATGGCTATAAAATTGAA TATTTTGGCGTTTCGAAACCCAAAAACATTTGTTTCCATGGCTAATGGATNTNCCCGGATGATCCCATTAATGATAATAA ATNATAAACATGACCAGGAAGGATTCNANACGTTNAAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1210: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860242153608AA441730SW3ICA2553SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12652212402592AA588929KJ4SLB390T3JHU93SL-BmL4 (JHU)


Date: 13:47:6 on Thu 23 Nov 117.