CBrugiaQ_122


Sequence

>CBrugiaQ_122 (4 EST) Length=1110 ATTACTTTACCAATTAAAAAAATTAAATAGTTGGCAGGAATTAAATGAATGGAAAAATGGAGAATAACACAGTGAAAAAC TGATATAAGGCATTCCAGTTGATGAAACGGAAAACACATCAAGTTTTATTGATGTTTTCCAAGTTTTATCAAGTTTTCCG ATGCTTCACTGTAAATATTGAACTATTTCAGACTCACAGATCTTCCACGTAGATTGTAGGTATCATTTATTAAAATTACA TGCATCATTTGAGGTTTAACAAAGAACACTGATAGAATTTCAGCCTTTGCAAAACTTTAAGTTTGGCAGAATCTGTGAAT ATCACATTTGGTCAGTATTGGAAAGTCATGGTGAAACCAGAGCGAGGACAACACTGGCTTCACACACATTTCTTCTGATA AAAAAGTATCAGGTTGGTCTGTTCCGAATAATCCCATAAAAATACCCTTTTAAAGCCTGCAATTTAACAGTAATTTGTTT ATCTTTAGCTGCCATTAACGACGACGACGACAACAACGAGGGAGGAAGGAAAGGAGGGAGAGCGAATAAGAAAGAGAGAA ACCCCAACCATGAACATATTACATTTGGTATAGAGTAACCCTAGGATGCCCCATTACAAGAAAAAAACTGTACAAATTTA TAAATAAACAGTTAAACAGTGTCCCCACCAGTGAATACACACATTTATACCAGAGTCTCTTTCCTTTTGCCTCGTGCCGA ATCGGCACGAGCCTGCATTTGACCGANGAAAATCTTTCGCCTTTTACTAAAGATTTCCGTGCAGGAGAGTATTTATGATT GTTAACATATTTTTTGGAAGCCCTTTAAGGATTGTTAATTTTATTTTATATAAACAAAGAAATGTATCCTTTACTTTCTT TATCTGCAATGTATTTATTTATTTGTTCATTTATTTATTTGCTTGTTTACTTATTTATTCATTTATTTAATTAATTAATT ATTTTATTTATCTATTTCAGTGACTGACTAATTAATTAATTGATTATTTAACTAGAACTTAATTAACCGACAAATATTTA ATCAGTTAATTAATTATAAATTAATGGATTGACAAATTGGTANATCAATTAATAAATTTTAATAAACAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_122: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6000671416490W91823SWAMCA1035SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8003271737710AA161680MBAFCG0F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483192064966AA406701MBAFCZ7E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12139092334991AA563526SWMFCA2481SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:5:38 on Fri 24 Nov 117.