CBrugiaQ_1236


Sequence

>CBrugiaQ_1236 (2 EST) Length=465 GNCANAAAAATCCCCCCAAGANATTTNGGGTGGAAGGCAATCANTGGGGGNGGNAAGGATNCAGTGAGTTGCCTACTTCA GCTACANCCTGTATGCTTTTTCGATGAANTCGANAATTATGCTGNTNTTGAANNTCGTTAGATTCCACATCCCCCAGATC ATCTAGACCAGTGCTATTTTCGNAATAATTTGGGAGGANATCATCATCATGATGGANATGCAACCATGATTTTTCTTCAT TGTAGTATGCGAAATATCTGGTTACTAACCGAAATTAAAAGATTGTTCAACCAACAAATTTATCCAATTGAAGTATCCTT GCTTCTCCAAGGCTGACAATAAACTTCAGTTTCCGAAACTTATCAACCAGACGTAACTTTTGGTATTCCTTTGAACTGCT TATTGATATACAAGTGCAGTATCCTAAACCCAGGAAAAGAATATATCGGAAAGATGGTCGATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1236: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217741808563R47676SWAMCA126SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4447311167628N43246SW3ICA682SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:9:41 on Thu 23 Nov 117.