CBrugiaQ_124


Sequence

>CBrugiaQ_124 (8 EST) Length=750 GGTGGGAATTTTTAGGGAACTNTCCTGTATGCAACTGGCAAAAACATATTTGGTTTCAGTAATGTCCCCCCCNAGTAAAC ATGATGATCAATCAGCCCCTTGTAAGTATATGACAGAACAAGTTCTGGGACCTTCTGGACATCGATGAAGATCATGTTCA CCATCGGGCAAAGTTTCGGGTTCTACAATTGGTACCAANCCATGCTGCTGGCAGATTGAAGCATAACGAGCCAAAACTTC AGCAATTTCAACCAGAGCCATATGGCTAGGTGTTGTTGCACCAATTTTATGCACGCAGCGCCATTTAGCAAACTGTGCAC CATCCTTCTTGTACTGGGCACATCGGTTGTTCAAATCATCTAAGCCTTGCGTGGTACCTTCACCAACAGTGCCTGCCATT GGAATAACACCTTTATCAACTTTGATGCCTGGGAGAATACCCTTCTTTTGTAGGACTTGAACAAATGGTGTACCATCATC TGCTTTCTGGTAGAATGTCTCATGAAACATAATAACACCAGAAATATACTTACTCATTTCATCACCAGCTGTGAAAAGAA GCTGACGATACAAACGTCGATTTTCTTCAACATTTTCAAGCCCAATTGGCTTCAGTTTTTTGTCCATGCTTCCAGTACTC TCATCCGCAGCAAGAATACCTTTACCAGGTGTTACAATTTGATTAGCGATTTGTCGCAATTCATCCTTCTGCGCATCTGT TAGAAACTGAGAGTAGGAAGTCATTTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_124: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4426991164847N41249SW3ICA653SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450201172402N43519SW3ICA869SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7244751631385AA088158SWAFCA024SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7620081681876AA123565MBAFCE7H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8855321876936AA246128SWMFCA1594SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8983341892939AA257463MBAFCZ0C2T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10987992167969AA454300RRAMCA486SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12354962369591AA585038SWMFCA2882SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 20:54:45 on Wed 22 Nov 117.