CBrugiaQ_1245


Sequence

>CBrugiaQ_1245 (2 EST) Length=724 TTGGAATAAGTATTTCAGATCAGCAATNGTTAATTTACTGGAGTTCTTTGGAAGCAACTCCATCTAGGAAATCTTTTGCT AAAGTTTGCTTTATTCGCTGTAATGCCAAAACACGNTCTTCGATTGTTTCCAAACAAACCAGCTTGTGTATAAAAACATT CTTCGTTTGACCAATTCTATAAATACGATCACAGGCTTGTTGCTCGAGGGCAGGGTTCCAGTGCAAATCAACGAGAAACA GATGATTACCACCGACTAAATTCAACCCCACTCCGCCGGCTGTCAATGACAACAGCATAACATGAGGTCCACTATCCATC ATATTAAAGCTATTAGCTCTATTTTGCCTGTCACTACTCGAAACTTTCCCATTAATAGATGTATACAAAATTTTTTTCCG TTCCAAATGATACTCCAGAATGTTCAAAAGACTGGTCCATTGAACTTACAATAACACACTTATCGCCACAAGAAAGAGCA TAGTCCACTTGTTCAAATAATTTCTTGATCTTTGTTGAAATAAAAGTTTTCTGGAACAGCTGTTCCATTTGTTTATTCCC GTCCTCACCCAGTAACTTCTCGGTAAGAGCTTTTTCATCCAAAAGCGATATATTCGAAAAACACTTTGACAACATCCCAG CATCTTCATCCTCTTCAACGCCTAACATCTGGAGGGCTTCCATATCGACTGCCTGGTTTATTAATGCAAAATGCACACAG GCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1245: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8963201890000AA255397SW3ICA2437SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11163532199494AA471730MBAFCX5H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:28:23 on Thu 23 Nov 117.