CBrugiaQ_1246


Sequence

>CBrugiaQ_1246 (2 EST) Length=731 GAGGATTGTTTCTTATGCAATATGTGCAAAATCTCACTTGTTGATAAGCCATTTGGCAGTAAAAATGATCGAATTTTCTG TTCCAATTGTTATGACCAAGCATTTGCAACACGCTGTGATGGTTGTGGTGAAATATTTCGTGCCGGAATGAAAAAAATGG AATATAAAGGTAAGCAATGGCATGATAAATGTTTTTGTTGTGCATTATGCAAAACACCAATCGGTACTAAAAGTTTCATA CCTAAAAACGATGAAGTTTATTGTGCATCTTGCTATGAAGAAAAATTCGCAACAAGGTGTTGTAAATGTAAAAAGGTAAT AAGCACTGGTGGTGTAACATACAAAAATGAGCCATGGCATCGAAGAATGTTTCTGCTGTACAAATTGTAATACGTCCTTA GCTGGTCAAAGATTCACGTTCAAAAGACGAGAAACCATACTGTGCTAATTGTTACGGTGAATTATTCGCCAAGCGGTGCA ATGCTTGCGTTAAACCAATTACAGGAATTGGAGGTGCCAAATTTATTTCATTCGAAGATCGACATTGGCATAACGATTGT TTTATCTGCGCCCAGTGTTCGGCATCACTAGTTGGAAAAGGCTTTATAACAGATGCTGCCGACATTCTTTGTCCGGAATG TGCTAAAGCCAGATTGATGGCTGCTAATTCATGACTGATGCTAATCGATACATTGTTCTTTGATTACAGTAATAAACTAC ATTTGTACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1246: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11161992199340AA471576MBAFCX4A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12618402393036AA585624SW3D9CA344SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 6:41:3 on Tue 21 Nov 117.