CBrugiaQ_1250


Sequence

>CBrugiaQ_1250 (2 EST) Length=626 TTGCCCACAAGCTGGTTCGTGTCGTAACAAGACCNTTCTGGATTGTACTCAAGCCAAATAAGACGTGCCTGATGATCTTT GACATAATTTGCTGCGCGATTTACAGCTGCCATAAGTGGAAATTCGCGGTCAATTTCCCTAAAAGTTTAAACTTATGAAT TCCAANAACTAATTAACAAAAATCGAGCCATATGGACTTATTAATACCAAACGAGTTCCAATCAACTAGGTTAAAATTCC CAAGCCGTTAACCGTCTTAATAATTAAACGAAAATCATTTCTCAGCATTCTCAGTATTACAATTATTCAAACTTACCAGT GACATCAGATATTATACGAATGCTGATGTTTGTTCCATTAAATGCATTAGTAACATACTCTGCGACGTAAGGTGGTGACA TCCTTTGAGGATCAGAATCGCCAATATCGCGACAAACCGTAAATGATGCATCAAGTGCTTTTACTAATTTCATTAGCGTC TAAAAATTCGTATAAAAACTCTAAAACCTTTACATCCGCAGTAAAGAATGGTTAAGGCAATATAATCAAAATGACTCATG AAAATGGCTTTAAGGTGGCTGAATAGAATTTATCTAATTGCTTTTGCAAATATTCTTCGAAATACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1250: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675941849824AA228253SWMFCA663SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10751322113609AA430813RRAMCA1535SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:40:54 on Fri 17 Nov 117.