CBrugiaQ_1251


Sequence

>CBrugiaQ_1251 (2 EST) Length=499 GGAACCCAATCCGGCCAAAAANTAAAGGGGGGGAATAAGGGGACGGCAGGAAAATACCGGNAATGGTCCAAAATGGAAAG GTCCCTTCATCATTCAAAAACCNGGGGTAGGAATCACGGATCAGAAGTGTGCATTATCGCTGGGATGTCCATTCCTTCTC CCCAGTTTCTTTCGATAGTGTGGATCGCTCCAGTTTTCATATGGATCCTTATGGGTCATATGTAAACGCATCCATAATCT GGATAATTTCCGGCGTAACTTATAGCAATCGTCTTTGTCATACGGCTTGTAATCTTCTAGCCTCATTCCATATTTTATCG CCGCTGCTCGTCGCTCTTCTTCATTTTTTGGATAATCATCCGGCATGTGATCACGTGGATACCAACCATCGATTGTCAGT GGTCCTCTTTTGTTCATGCGACATGATGTGTGGATCGAACGTACACATAATAGCACGGAACGCGATGATACCATTACGTC ACGAAACCCTCAAACTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1251: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5931121397382W84925SWAMCA1076SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8390351795700AA199957SW3ICA1992SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:11:39 on Wed 22 Nov 117.