CBrugiaQ_126


Sequence

>CBrugiaQ_126 (3 EST) Length=817 ATATGATATCTTATTCTAGAAATTAATGACATATGGTTATAATATTAACAAATGTTTCTCGTTTCTTTCAGGGATAGCGT TCAAATGATGTTCACCTCTGTATTTGGCAGTTTCCTGAATTTTTGGTTATCTTTTGGAACAACGGCAACCTCAACTTCTG GATGCCCTTAAATCAACGCCCAAGGATGATTGCAAACATTCAAGAGCTAACGGCACGGTACCTTCGTAATCGTAATCAGT TTTTTTTCTGGAGCTTTTTCTCCAGAAAACTATTTGCAGGTTGTTGTTTAACACCAAACACCAACACAACGCATTCCTCG ATAATAACCAGCGGGATCTACGCGAAATATCGGAGGTCCCTCCTCATCATCATAGGAGATCAGCAGCATAACACAACCCA ATGAACGTAACTCAGCATTCTGAGTATAATACTGATTGAGATCAGCCATTCTCTTACTAAGCTGCTCTACCGACATGTTG TAACCATTCTTGTACTTCCATTCCGCTGCTTCTATTTGAGCTCGTTTCACTTGGAATTTACTATCCGGTATCATTCCCAC CATTGCACAGCCAATCGTTGGCGTTAATTGATACAAACTTGTCACAGAATCTGCCACAATCAGCTTATCAGGTACACGTT TCTGTACTGCGACAACAGCACAGTTGACACCTTTTACACCGACAGCTGTCAAATTCGTTGAATTTATCGCTTTGAAAGCA TATTCAACTTGGTACACTCTTCCCTCTGGAGAGAAGATTGTAAAATGACCGATCGAAGCCTGCACTGCTTCCACGCGACA TGTTGACCTCTCAAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_126: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679761850741AA228635RRAMCA412SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8944591887884AA253535SWMFCA1426SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9141231912493AA273119SWMFCA1972SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:41:52 on Thu 23 Nov 117.