CBrugiaQ_1260


Sequence

>CBrugiaQ_1260 (5 EST) Length=465 TTTGAGGTTACGGATGGTTCATGCGGCAAGTAATCAAATTGGCTAGTGTCACAAAGGTTTTTCGCGAGGCGAATTCCCAG AAGCCGAATCGCTATGATATGGAAAATTTGACAAAAAGAAAAAATACACTATTTGCTGAGTGGGCTCTAGGCGAAGAATT CACAGCAGAAGCTGTAGATAGCTTACAACACAAGATAACATTCGATCTAAAAGATCTAGACAACGTATTGACAGAGACAC ATGTCAAGGTGGATAATCCGAGGGACATCGAGACTTATGAATACTATCGAGATGGTGATTACTTGATCATGAAAATGACC TGTAAAGGAGTTTCGGCAAAACGTTATTACAAGAAGCAATAACTTAATATTATTTCATTCCATCATCTTTTATTTAAAGT CCTTTTGCTCGTCAACGTTGCTTTCATATCAAACAGCTCAGCATAAATCAGTTTTATACCCNATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1260: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5594751345296W51583AS4SLC778T3Brugia malayi L4 JHU93SL-BmL4
8196801763861AA180565MBAFCG2E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9140941912018AA273083SWMFCA1904SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9164161917036AA275401MB4SLY1A12T3Brugia malayi L4 JHU93SL-BmL4
12774142429556AA598363SWMFCA2924SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:28:29 on Mon 20 Nov 117.