CBrugiaQ_1269


Sequence

>CBrugiaQ_1269 (8 EST) Length=499 CGGCTCTCATTTTCCCATCGGAGTTTGAATCCATATCAACCATCGCCTTTGATTTGTTAGCTAATGATCGTTTCACTTGC TTCTTCGCGTTTCCTAGCGGGCGAACAAACTTTGTAGAACGCACAACAGTGAACATTTTATTTTTCCACCCTCCAGTCGG AGCTATAAAACACGTTTCATCATGATCCATCAAGAGTACTCTATCAAGGCCGGTATCGGGGTTTCGATACTTTAATCCTG TGGCATCCTTGAAAACATTTTTTAGTGTCCTGACATGCAGCACACCATGCGAAGGACATAAAGGAATCTCGATACCTTTG CTGCCTATAGCGCTCGACACCACAACCCACTCTTCCGGTGCACACACTGATTTTAATGATTCATCCGAGCTGCAGATCTG TTCCCCATCCATCTTACTGAACCTGGACGATAGTTAAGAGAGAATGATGACGATGAAATCAACAGTTCTGGACGAGAGTT AAGAGAGAATGATGACGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1269: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5406921313870W32840RRAMCA1219SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7472591660869AA109399MBAFCE1E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7619381681806AA123635MBAFCE7A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481912064838AA406859MBAFCZ6A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10988122167982AA454313MBAFCX0B03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161422199283AA471519MBAFCX3D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161582199299AA471535MBAFCX3F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536112246825AA508948MBAFCW1E07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:28:32 on Mon 20 Nov 117.