CBrugiaQ_1273


Sequence

>CBrugiaQ_1273 (2 EST) Length=584 GTTACATTTAAAACTTTCAAACTCGTAGTACAAAGACCGAACGTGTCGCCTTCTGCATTTCTGGATACATTCATTTGATA TCGAACATCAAAATATTGTACTGCAGCGCTATAAGGACTGATTGAGTGTTGTGTGTTAATTATAACATTCCATCATCTGC AATGACTGAAACTGAAACGAAAGTTACTACTGCTACTGATGAGGCTCCATATACAAACTCACCAGTAGCAGAAAACAAAT TGCCAACATCAGTCAACTCTGATGAAGATATCCCTGCTGTTGATGCTGATGTGAAAGATTTAAATACCCTTGAACCAAAG GAACTTGAAGCGAAGGAAAAAGTGCCAGAATCACGGAAGGACCCAAGAGAAGATCCGATTGGTTGGGTGAATTCACTAAT TCCCGGTGGCCGTCCACAAGGTTAATTACCGATTGTTAGACTGGGCTCAGCAGCTGGCCATTGAATAAGAAGGCAAACGG CAAATATTGCCTGGCAAAAGTGATGCTGTCACAAAGAATCAGTTTTTGTCGTTTCTTCGAGATGGATCACTGCTAGCGAA ATTAGCTAATCGTCTTCAGCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1273: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11538392247053AA509176MBAFCX8B09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11939422315094AA547893MB3D6V2D08T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 9:29:14 on Sun 19 Nov 117.