CBrugiaQ_1275


Sequence

>CBrugiaQ_1275 (3 EST) Length=523 GGTAAAATGAAGAGTACTGAGAATGAAGCAGAAGTGGAAACTGTAGCAAAGGACAAACAACCCATTAATGATAAGAAAGA AGAAGTGGGAAGAAATGTGGATGCATTCCAAGGGTGGGTTACCACGGGTTCAGCTTGGTTCCGATCCGCTAAAAAAAAGA CCTATACAACCTTCGAACTGGTCAAAAAAGACTGACTGAGTTCAGCGATGTTGTAGCCAGTGAAGCAAGCGCTTTGGCAA ATACTACTGTTGAAAGCGTCAAACAGCAAGCGTACAATTTGCAGCAAATTATGAGCTTGGAAGAATATGATAAGCAGCAT AAAGAGGAGAGTAAAAGAATGGAAAATAATGCAAATGAAGTGTGTTTTTAGTTGTNGACGANATCACTGTANNGTTCAAG ATTAANGTTCGGAAAGTAATTAGGTCTGGTAAAAGAATTCATGACTTTTTTCTGTGTCAATTGAAGTTAAGTTTTGCTCA ATTGAATCATCTTTTTTTTTTTTGGTTNACCCNCCAATTAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1275: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4706301215761N64879SW3ICA1343SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7566511673276AA118227MBAFCE6G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620971681965AA123670SW3ICA1895SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 7:20:39 on Sun 19 Nov 117.