CBrugiaQ_1281


Sequence

>CBrugiaQ_1281 (2 EST) Length=463 AAGTTTGAGGGAATCAATAAGCGCTCCGCAACAATGACAAATGCGCAAATCTTATTTTTTACGTCACCATTACTGCTCTA CGTTCTTAGCACACTGATATTGTTAGCAACACCTCAGAGATTGATTCCGGCATCTGACGACGATTTGGGCAAAAACGATG AAATTCCCAATCAAGAAAACGTGGGTGGATTTGATGAAAACATTGAATTTATGCAACAAGATATTATTTCTATTGAAAGT TCATCGTGGAATACCGCCACAGATGATGAAAGAACTGTGCTAGACGGACTTTTAGAGGAAGGATATATCAATGAAACAAT GCTACCATGGAACAGTGGTCGACCACTTCTGATTAAAGTTTATTGGGGAGCTAGTGTTTGATGAAATATTCGCCCTTGAA GTCTTGTTAATAATTCTGTAAAATCCTGTGACGTTTGTTGATGAATAAAACTAAAATTTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_1281: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6363581486123AA022341SWMFCA461SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9100251906090AA269022SWMFCA1818SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:58:51 on Sat 18 Nov 117.