CBrugiaQ_1286


Sequence

>CBrugiaQ_1286 (2 EST) Length=590 AAGTGTGATCTTTAAGAGCACCCCATTCGGCACATTTATGCTGGCATACGGAGCAAATATAGCCATGTTCTTCCTTTTGA TGTTCTTCCATCCAGACAAAACGATTACATTTGAAGTCACAGATTCGACATTCAAATTTGATTATACCCGTATGAATACG CTCATGTGTTGTCACCGAACATTCGCTTGTGAATAGTTCGTCACAAAAGTGGCAAGGGAAAGTTTTCGTGAAAACGTGAG CCATTTTCTTGTGCTTCCTGAGTTTTCGCGGTGTAAGAAATTTCAACGTACACATATTACATTTGAAACCTGAATTCGCA CCACGATGAAACTTAGCCCGATGGTTAAGCAATCTTTGCTGCGTGCAAAGATTTCTCAGAGGAGTACATTCAAAGCAGAC AAATGTCAAGTCACATTCATGCGCTGAGAGTTCGTTTTTCGGTGTCACCGCTTTGAAACAACGTAAACACTGAACAAAAT CAACGGTTTCTGGATGCTTCTTCACAAAATGCTTCTTCAAGGAAACCTCATTCCTGAACCGTTGTTCCTCGTGCCGAATT CNTGCAGCCCGGGGGATCCAATAGTTTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1286: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11162522199393AA471629MBAFCX4G04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11939472315099AA547898MB3D6V2E03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 11:57:9 on Thu 23 Nov 117.