CBrugiaQ_1287


Sequence

>CBrugiaQ_1287 (2 EST) Length=168 ATGGAGTTTAGTCATNACCCTATTATATTTGGGCTAGGTGTGTTAGGTATTGAGGGTGGATTAGGGTGGCAAATGAGTAT AGGTATGGGCCGTTCTAAAACGATTTGTCTATCATATCTNTTATATGNTNCCTNAGGATGNATAAAGGATGTCTGGGGGG AGGANATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1287: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451041182131N43551SW3ICA836SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451071182134N43554SW3ICA840SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:34:11 on Thu 23 Nov 117.