CBrugiaQ_1308


Sequence

>CBrugiaQ_1308 (2 EST) Length=412 ATTTACCCACCGTNTGTGGGCGGCNGCTCGACCAGCGTGCCGAATTACGGCACCAGGTTTGAAGGCAAAAATGTGGCTAA TNATTTTCCCTGAGCGCCTACATTGTCATTGTTGTAGTGCATACAGCTAATGCATTTCTCAAACAAAGCGTACGCGTCAG GGGAACAACTGCTATGTGGTTCCCAGCCACCTTCCACCATCCTAGTGGAAATTAGTCAATAAAAATAATGGTCCAAATCC GGATAATTTAATGGATTCCTGTTATACAAATAGTGGTGGCAAATTTGATTTACAGGGGCAATTCATATGAATTATCGACG ATCGACCCCGAAGTGCGTATTTATCACGACTGCAACGATTACGGAAGGGCATGTGTTATTCACTTTCTTTTAAAATAAAT TTGGGAAAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1308: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5072381271722W00308RRAMCA1117SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12652112402582AA588919KJ4SLB387T3JHU93SL-BmL4 (JHU)


Date: 2:38:48 on Thu 23 Nov 117.