CBrugiaQ_1318


Sequence

>CBrugiaQ_1318 (2 EST) Length=461 GAATATTGGCGCAAATCCTACGAATCCTCAGAAGATTGCCCAGAAGCAGCCGGCAGCCCCACCCGCAAGGTGAANATGCG GAGACACTGAGGCTGTGTGCCCTCCTGGGACTCTGGCTAATCCTGATGTAGCTGCCCCATCTTCTGTTTCATTTGAGTGT TTTTCTTTGTTTGTTTGTTATTTAGGTCCTATATACGTTTTCCTTGCTTCGTCGCCCATTAAAGCTAAAGAACACAAATT GGCAAAAGACCTGGGTTCTTAGGTTCTTGGCTTTCCTCTTTGATGAAAAAGGCTGTTAGCTTCTGTAGGGGAACACTCTT ACCACAATTAGCCACTTAAAAACAGTGGGAACAACTGTCTTCAAATTGGAACTCNGTCANGCTAAGGTTATTTNAACACA CAAAAATGTTTTGNGTTAATGAATTCTTGTTTGGGCNTTAAATGTTNATCTCCGCACGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1318: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6364591486224AA022442SWMFCA693SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6838301550589AA057936SWMFCA957SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 5:2:14 on Tue 21 Nov 117.