CBrugiaQ_132


Sequence

>CBrugiaQ_132 (5 EST) Length=724 TGAGATTCAATTGCATCTATTTCAACTCGATTATTCTTAACACTTCCGAGTTTTAATACAGCCATGCGCGAAGTGATATC AGTACACGTGGGCCAAGCTGGTGTTCAAATTGGAAATGCTTGCTGGGAATTGTTTTGTTTGGAGCACGGGATTCAACCTG ATGGACGTATGCCATCAGATAAACAGAGCCAAATTGACGACTCGTTCTCAACATTCTTCTCAGAGACGGGGACTGGTCGT CATGTCCCGCGAGCAATTATGGTTGATCTGGAACCAACAGTAGTAGATGAGATCAGAACCGGAACATACAAGCAGCTTTT TCATCCTGAGCAGATGGTCACCGGTAAAGAAGATGCTGCGAATAATTATGCACGAGGACATTACACAATTGGGAAAGAAG TGATTGATTTGGTACTTGACCGCATCCGACGTTTGGCTGAGAATTGTACTGGTTTACAGGGTTTCTTGATTTTCCACTCG TTTGGTGGCGGACTGGTTCGGGTTTTACGTCCTGTTGATGGAACAATATCTGTTGACTACGGTAAAAAGAGTAAATTGGA ATTTCGATATATCCACTCCGCAGTTTCTACCGCTGTTGTAGAACCATACAATCTTATACTTACGACCATACTACTCTTGA ACATCTGATTGCGCTTTATGGTGATAACAAACTATTATGATATTGCCGTCCAATTGGATTTGAAAACATCTACACAATCT AATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_132: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217583808405R47518SW3ICA011SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291545902077H30921SW3ICA135SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448451167742N43344SWMFCA156SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212432344737AA570847SWMFCA2609SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212442344738AA570848SWMFCA2610SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 20:55:12 on Sun 19 Nov 117.