CBrugiaQ_1321


Sequence

>CBrugiaQ_1321 (6 EST) Length=637 TCATGGTCATCATCATTGCTCCACGTGAACGTGTTANTGGACCAGATGGAATTGTCNTCTCANNATGTACTGCNTTTGGT TTTTTTGAATNACATCGAGCAGTAATTTTCTTAGCTTTTCCATTTGTGAGCGATTTTGTTCTATTTGAAATTGTTGGCGT AGCAGTGGTCGCTTTACGTGTTTTACTTAATTTTTTTTTCTTTTTAACTTGTGTACGATTATGCTTTGATGTTGATGAAA CTAACTCGTCGTCGTAATCTTCCTCATAATCTTTCCTGAATTTATATTGAAGAAAAAAAAGTNACAAAAATTTTTTAAAT TTTCTTCAGAATTAAATTAGACGATAATTTATTACATGCACTTAACATGATATGATGGTGTACGACGATGATTATATGAT CGATGATTTTGATCATAATCATAAAATTCTTCATCACTCGTGCCGAATTCGGCACGAGTTTGATTGGCTTCGCTATACAC TGACTGATTATATTTTATACAAGTATTGTTCCGTGCGTGTGCCAAAGTCTTTCGTCGTATTTTTGTGTGGTCAATTTAAA GTCTGTTCACGAATACAACGCTACTATACGTGTTCAGCAATCGGTAACATTGTGCATAAAGCATCGTCGCTTAAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1321: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6674941531504AA051798SWAMCA1424SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6675061531516AA051810SWAMCA1437SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10774642125768AA433170RRAMCA1613SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10797772140397AA435483SWAMCA1742SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10797812140401AA435487SWAMCA1747SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11537142246928AA509051MBAFCX6F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:57:23 on Thu 23 Nov 117.