CBrugiaQ_1322


Sequence

>CBrugiaQ_1322 (3 EST) Length=459 TGCGAGCGGTGTGATTGTCGACATACATAGAACCATTCCTCATTCTTGGCCGTCTTGTTATTTCCCCCTAAGCGTCCACT GCAATATGCCAAAAAAGAAGTCAGGTGCTCGGAAGAAGGCTGAAAAGCAACGGGAAATTCGAAAAGAAATCCAGAATAGT ATTGTAAAAGATATTACACGTCATCCATGCAATGAACTGATGCAGTGCGATAAATGTTCCCGAAACCAGAAGACTCGAGC ATTTTGTTATTTCTGTAATTCAGTAAATAAAGCACCAATATGTGCAGCTTGTGGTAAACAGAAATGTTTTATGAAAGGGG GAGATTGTATTACCAAACATGCTGGGAGATGTGTAACGGGTTTGCAAATGATGGGCGCACTATGTGATTATTGTGAAGCA TTCATATGCCATAGTAAAAAATGTCTTACAACTCATCCATGTAAATGTCCATTGCGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1322: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6462411502071AA032099SWAMCA1090SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10614262078576AA417392RRAMCA1388SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10751022113579AA430897RRAMCA1494SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:44:40 on Sat 25 Nov 117.