CBrugiaQ_1324


Sequence

>CBrugiaQ_1324 (5 EST) Length=742 TGATATCAAGACATAAATAATCATTGAAATAGTAGAATACTACCTACACATGGAACAAAAGTTAATACATAAGTTAAAAT AAAATTGTAAGTAAAAATAATGTTATCACGGGCAAAAAACCGAGTGATTAATTATCAGATCATAATAGATCGCTATTAAT TATCTATCTGTTAAAACTAGATTATTAAATATACCAGGATAGAATATTGCATTTCTATTGAAAATAAAGTAAAGAAATAT TATCGTTTTTGTCCATCCAGAAACATTTGATAATTGTTTCAGATGTTGAAATACCTCACAAGTTGCCATTACATCCACAT TTACTGCAGCGCATGCACTTCTGCATGCTACATTCATGCATGCCTGCTTATTTGTTGTTGAAACCATGCATAAGCAATAA GCTCATTTTTGAAAACGTTTGTAAAAATTGGCTCATTTTGATAGTCAATAGTATTTTAGGTTAGAACCTCAAACTTGCGG CACGAGCTCGTGCCGAATTCGGCACGAGGTTTAGCCAGGCATTCTCCAAGAAACCAAAACAATAATGAGCTTACAAAACC TATGTATCTTTGCAAAAACTACTCCTCTTGCTGCCTCCAGAGCTCTTTTCCCAAAATAGGCACTGTGGTGTGTTCTGGAA TCTGTGCAAATCATCTACCTTAAAGTTCTGTCTGCCCTAATTCTGCACAAAACAGGTTTTAAATAGGCTCTGAATCCGCG ACATTGCGCTTAGTGCCACCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1324: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983311892936AA257460MBAFCZ0B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984631893068AA257592MBAFCZ1G1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537952247009AA509132MBAFCX7F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538052247019AA509142MBAFCX7G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11939652315117AA547916MB3D6V2G03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 18:36:41 on Sat 18 Nov 117.