CBrugiaQ_1330


Sequence

>CBrugiaQ_1330 (4 EST) Length=467 GGATAACTACGGATTATCACCATGGATTACGCTGTATCATATCTCTATTCTGATAATTCATTCGGATTCATTTTATCGGA AACATCAAATGAACCAAATGTAGATGAAATATGTGTATCATCGTCTTCTGTCATATCAAATTTATCTGGGTTGAAGTATC CATGGTGACGGTGAACCACTTACGGTAACTTCATTTGAGACAAGATGATGAACTCGTTTATAGAAGAAATCAGGAATCAT ATAGAAAAGAATTGAAATTGTTATTAAAGATAGTAAAATTAGGAATAAATGTGATGTACCATATCTTTTCTTAGCAACAA TGGATGAGATAGGAAGAGTAATAGGATAAAGGGTAGTTTGTGGTGTTGTCGATGATATTGTAATTCCTTCCATTTCTTTT GATTTTTCATCGCCTTCTTTCACATTTGAACTTAATGCAAAAATTTTTGTCATCTCAAATCGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1330: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320183944799R86393SW3ICA342SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445561167357N43055SW3ICA1051SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8963311890011AA255408SW3ICA2448SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9076591902764AA266676SW3ICA2362SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 16:21:0 on Fri 17 Nov 117.