CBrugiaQ_1331


Sequence

>CBrugiaQ_1331 (2 EST) Length=469 CAATGGTTGCTTCCCCGGCTGGTCGGTTCTGAGCCATCCNNCTGATAAGCCTGCCTAAGTGATTTGCAGCGGAATTTAGT AAGAAATGCTAGACAAATAGCAGCAGATCGCGATATCCCAGCCACACAGTGCGCCCNATACATTGCCACCCACTTGCTAT TNCCGCCTCAATCTGGTCAGTTTGTTGGTCTAGCAAAGGATAAATAGAAGCCTGTGGGGTATCTTCAAGCCACAGTTTTA CTCGTGGAATATTGCCTAATGACTGCACATTTGGTACCTCGTTAGTAGCATTGACAATGAATGAAATATCATATTTTTTC ATGTTTTCAGCCGTTAAAGAGCTAACACCGCAGATGAATAAGCCACGTACAATTTCCGTAATTTGCGCGTATTCAGGATT CACATTAAATGACACCGGTGACATTTTCGGAGATCTCGTGCCGAATCCTCACCCNGGNNNNNNNNNNNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_1331: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445421167343N43041SW3ICA1037SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445471167348N43046SW3ICA1042SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 20:34:43 on Tue 21 Nov 117.