CBrugiaQ_1337


Sequence

>CBrugiaQ_1337 (2 EST) Length=457 AGGTGACGTTTTGACATAAGACATCTATTTGAAAACTATTCAGNTTAATGAATTGAATTTCACTCTTGATAAAAACCATC CAAAACAAAATGATTTGTATCTCTTCCACTTTTACTATAATTTATTTACAACTAACGTATTAAAAGTTTTTGTTTTGGGC ATTGAAATAATTCCGAAAAATTTTTGCTGTGAAACATTGAGGAAGTTGTAGTATTATCACTCATAATATAGCATAGTGAA AACTGTTACGAAAAAAATCGTTCATAATTTAAACTTTTATCTTGTAGTCTTTGAGCAAACATTTGGAAGTTTTAATATCC ATTGTTATTGGCGTCAATGTCGGTATGTGATGTTCGTTGTCATTATAGCCATGAAATGCAGAACTTTAAATAGTACTGCC CTGTTAAACATTAATGAATCTTCTATTTGATAGTGTAGAAATAAAGTGACAGTCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1337: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196321763813AA180621MBAFCG1B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12212932345190AA570897SWMFCA2670SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:4:11 on Fri 24 Nov 117.