CBrugiaQ_1339


Sequence

>CBrugiaQ_1339 (19 EST) Length=1074 CCAAGTTTGAGAGTTTGGTTGGACAGTTAACCAGGATTTAAATTATCTGTAAAATAGTGAACAATGTGCATCGCAAAGAC AACAACAACTGTAGCTCAACGCTCGCTTTGCAACAAATTACCGGTGAAACAACTGGTGGTACCATTCAGATCCAAATGTA CCACATTCATCGAAGAACCAATTTACAGACCACGTTTCAGAAAACAGGACTGGGAACAGAGCTCACTATGGGGAAAACTT TCCGGCCGCATGTATGATGCATGGCATTCATCATACTTTGGAAAGCGATTTGCTTTTGGCTTAGCATTCGTCTGGTATAT GTTTCAGGATTTGGAGAATCATTATGTCTTCATTGATGCTATGAATAACAACTTTGAAGAATTCAAGGAAAAAGATGAAG AAGAGGAATGAGATGATCTATGACAATATATCATACGAACAATAAACTGGTAATGGAAACTGTTCAAAGCGAAACTCTAG TAGAAATTAATTAATCAATTTGTATATTTAAAATTTTGATGTCTTCGAATGGTTAAAATTCTTCACCATATTTTTATTTT GCTATTCTCACACTTTCGTTTTACTTTTGAAAATGTAAGATAGAAATGAAAGTGTTATAATTAAAAATGATAACAAACAT ACCTTAGCTTTTCTTATCTCTTGTAATTCAAATAAACCGATCATTACTAAAAAAAAACTCGTGCCGAATTCGGCACGAGT TTTATTTAAACCAATAATGCATTTTTATCTACGGAAATATTATAAAATCTGAAAATAAAACGAAACAAAACAAAACAAAA CAAAAAAGTAAAATAAAATAAAAAGATAGGAAGTTATAAAAGAGGAAATTTTGCAACTTTTATACAGTTAATTTACCATA TAAATAGCATTCCATTGCTCGCCTTACCGATAACTGATGAAATATCGCATAACAACGAAATCGGCACGTATGCAAGGACG AACGAATTGAGAATGGAAAATAGGTAATCTGGCAGAAATGGATTTTGCACAACAGTTATCGGCGTCATATCATATCATAT TATAGTAACATCGATTGTATCATACAAAAAGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1339: (19 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
276433881999H16495AS3ISB308SLBrugia malayi infective L3 JHU93SL-BmL3
320241945442R86415SWAMCA376SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
354107992881H52885SW3ICA429SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4809611236198N74799RRAMCA1070SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5251741293880W18206SWAMCA653SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5305271300277W23423RRAMCA1306SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6806831547246AA054912SWAMCA1501SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6807341547297AA054890RRAMCA276SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7523211668305AA114409MBAFCE4D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7619721681840AA123516MBAFCE7D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9164791917099AA275464MB4SLY1G10T3Brugia malayi L4 JHU93SL-BmL4
10901842158555AA445890SWAMCA1729SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11163072199448AA471684MBAFCX5D07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536302246844AA508967MBAFCW1G03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12619192393115AA585703SW3D9CA492SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13247312539374AA626987MBAFCW2B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814422655562AA675856MBAFCW5F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814482655568AA675862MBAFCW5F09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13860762660438AA680490SWAMCA3087SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:30:13 on Fri 24 Nov 117.