CBrugiaQ_134


Sequence

>CBrugiaQ_134 (10 EST) Length=770 GGNTTTTCAAGCAATTCATTTNTCAATTTCGGNTNAANGCAAACAAACATTAACAACAGTGGACAAACACATTAAAATTC AATTTNGTNGNGGGGGNGCCCCCCATTGTGTTCTTTATAGGTAGNGACNGCAACATTCTGCCATTTNTTCTTCAACAAAG AACACAAGGAAATTGATAGAAGGAGCGATATTAGAAACCAGTTCTTCCGGGTCATTCCAAACATGTCCAATTGCTACCGA TAGGCATAATACCTTTTTCATTTGAAATTTGATCGTTGAACGGATCTCTTCAATTTTAGTTATCAGTGGTTCAGAATGAG CAACAACACTTGGAAATTTACCAGCCTTATTTAGACCTGGTCCAAGTATACGTGGAATTTGCTTAATCAAAGCTTCCGAA GCCAAGAATGCATCATACCCCTTTGCTAGCTTCTTGATCAGCTTCTTATTTTTGTTCAGTTTTTTTAATTCATCCGCATT CATGCACGGTATACTGTTTGCGTTAGCTTCATCGCAATGTTGTTGATCGCCCAATACACACACTTTCATATTTGGTCTTG GTATATTTTTCAGCCTTACGGATCCACTGAAACGTTTATCTTTCTGTGGATCATAATTCTTCAGTGCTACTTGTAATTCG ACTGTTTCACGAAATTTCCGCTTCTTTTCCTTCGATGCTTTCAACACCTCATTGACACATTCGAAAAGCGTATCACGTGG AATTTTACTCATTGTATAAGATTTAACGCCTACTGAACAATACCCTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_134: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7272081634853AA089374SWAFCA75SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7523251668309AA114413MBAFCE4E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8713021854958AA231995SWMFCA1297SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8809581870942AA241572MBL2SJ2F12T3Brugia malayi second stage larvae JHU96SL-BmL2
8811151871099AA241638MBL2SJ9G1T3Brugia malayi second stage larvae JHU96SL-BmL2
8985501893155AA257678MBAFCZ2G7T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8986361893241AA257751MBAFCZ3G7T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480312064678AA406686MBAFCZ2G07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12354522369547AA584994SWMFCA2815SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13669242605462AA661418MBAFCW3G06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:3:19 on Tue 21 Nov 117.