CBrugiaQ_1345


Sequence

>CBrugiaQ_1345 (2 EST) Length=457 GAGTTCAAAGGCTATCTATTTAAGATCATGGGAGGATGTGACAAACAGGGTTTCCCCATGAAGCAGGGAGTATTGACTCC AGGACGTGTTCGTCTTCTTCTTCACAGAGGAACACCGTGCTTCCGTGGATATGGAAGACGCAATGGAGAACGAAGGCGAA AGTCAGTCCGGGGATGCATTGTTAGCCCTGATCTTTCTGTTCTGAATCTTGTGATTGTTAAGAAAGGAGATAATGATCTT CCTGGTTTGACTGATACCGAGAAGCCAAGGATGAGGGGTCCCAAGAGAGCCTCCAAAATCCGCAAGCTCTTCAACCTTTC TAAGGAAGATGACGTCCGCAAGTATGTCAATACTTACCGCAGGACCTACACCAATAAAAAAGGCTAGACAGTTAGCAAGG CCCCGAAGATACAAAGGCTTGTGACTCCATTAACATTGCAAAGGAAGAGAGCTAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1345: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11938552315007AA547806MB3D6V1B05T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668012605339AA661295MB3D6V5C03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 17:57:43 on Tue 21 Nov 117.