CBrugiaQ_1348


Sequence

>CBrugiaQ_1348 (2 EST) Length=467 CGGTGCTTCACAATACGGCGGAGGTGAAGCAGCGGGCGGAATATACGGAGGGGCTGCACCTGAATTACCACCACCACCGC CACCTGCACAACAGGTCAATCAGCAACCGTTTCAGGAGCAGTCATCAGCACTGACTGCGGAAGCTCCTCCTATGGCTGCA CCTGCTCCAGCACCTTCATATCAGGAGCAATCACAACCGCTACCAGCTCCAGCTCCCGGACCATCAGCATTTGCGGAACA AGGTAGCAGTGGAGCTCTTGCACAAACATATCAAGAAGCCGGCAGTGATACAGCGATAGCTGGTAGCCAGGCGGGCAGTG GTTACCGTGATCGATTGAAGTTTGCAAAAGTCTTCAAGCAACAATTGGCAAGTTAGGCTCTATAAAACATTAATTTCCTT ATCTTTCCCTCTTTACCTGTTGCCTTTTTTATCCCTAATTTCCAAGGAATGAATTTAGAAGAAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1348: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617182392914AA585502SW3D9CA049SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12618082393004AA585592SW3D9CA271SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 19:56:17 on Sat 18 Nov 117.