CBrugiaQ_1352


Sequence

>CBrugiaQ_1352 (5 EST) Length=872 GAACGAAAATATTTTTATTCAATAAATTAGAAACAGCAGGAACAAACATCACTGGTAATTCACATCGACAAAAGAACAAG GATAAACCAACATGGGAGAATACCTCTCCTTCAGAATATCATCAGGAAATAGTAGTGGTCGGGAAAACGGGTACTATTTG GCAGTTGAGAACAGAGCAACCAAACCGGCTGCACCAACCATAGAAAACAGACAATTGAAAGTGGACGATATAGAAGCGAA TAAAAAGAATGATAAAATAAGAAGAAGTGAAAGAAAAAGAATATTATTCCAAAAGATAGAAAAAGTAGTCGCTTCGTAAT CTCCGACCTCATTTTTCTTCCATAAAATTCTTTCATCTTTCTCTTTTTTCGACATTTTTTTATCATCTGCTAATTTTCGA TTCATTTCACGAGTTATTGCCTCACTCCTTTTTACAACAATCTTATGCTTCAGAATGTGCTTGATATTCTTGTAGGCAAA ACTGATAAGATAGGATGCAGTTAGCGATGAAATTAACCAAATGATCCACGAATCAGTCACTTCCATCTGATGTATTCCAT GGAAAAGGTATAGAGGTGCAATAGCAATCACTGTCGAATTTCCATAGAACAATGCACTGCCCTTTGCTGACACTGCTGCC GAGAAATCCTTTAGCAGTAATTCGTCTTCCTTTGACAACTTCTGCCCCGCTCCTTTTGACATGTTTGAGCAATTAATAAG ATAATCTACCTCAAATGCACAATCACACCTGAATGTAAAGCTCCTGCATTACTTGCAACATAGTACCCTCATACACAGTG ATGTCATAGAAGTAGTTAATCACCGCGCCATAAGTAAAGACACGCGAAGACACGCAGCATGCCCCACTCCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1352: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7497131663803AA111827MBAFCE2H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7523841668368AA114520MBAFCE5G06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8808541870838AA241520MBL2SJ0D9T3Brugia malayi second stage larvae JHU96SL-BmL2
10481192064766AA406657MBAFCZ4E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11253492209417AA480719SWMFCA2075SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:50:46 on Fri 17 Nov 117.